Primers are key ingredients in DNA synthesis, a process that occurs in sequencing, cloning, PCR, and other molecular biology methods in the lab.
With Benchling, teams can easily access shared primer libraries, upload new primer sequences, or design brand new primers. Link primer information directly in the Benchling Notebook and Benchling Registry providing full traceability for every experiment where a primer was used. Be able to easily attribute results from experiments with the exact set of primers used, or see which sequences a primer is associated with. Once primers are designed, run in silico PCR, or use them to plan critical tasks such as restriction cloning, Golden Gate assembly, and Gibson cloning.
What are primers?
Primers are simple but key ingredients for DNA synthesis both within our bodies and within scientific experiments. Primers can also be called oligonucleotides and are literally small pieces of single-stranded nucleotides, generally about 5 – 22 base pairs in length. The main property of primers is they must be complementary to the DNA template strand, serving to “prime” the strand for DNA polymerase to bind to and initiate DNA synthesis.
What types of primers are there? RNA vs DNA primers
Living organisms solely use RNA primers, while primers used in the lab are usually DNA primers. Scientists use DNA primers instead of RNA primers for a variety or reasons. DNA primers are far more stable and easier to store, and they require less hard-to-come-by enzymes to initiate synthesis.
Problem:
Based on the template and primer sequences, can you hypothesize why the PCR reaction
didn’t work?
Template:
5’ATACACCCCAGAGATACTAGTACGGGATCGTAATCG3’
Forward primer 5’TATGTGGGGTCTCTA3’
Reverse primer 5’TGCCCTAGCATTAGC3’
1 view
16
4
5 days ago 00:02:56 1
Oh Wonder - Technicolour Beat - 10 Years On (Official Audio)
5 days ago 00:02:19 1
How to DO Block Blast Glitch - GET HIGH SCORE with Block Blast Hack/MOD APK iOS & Android
6 days ago 00:14:37 1
🔴 As US Cozies Up To Russia’s Economy, Putin’s Call With China Just Changed Everything
6 days ago 00:11:17 1
Potato Tour of Russia 2025: From Storage to Processing at the WEFRY Plant
6 days ago 00:04:19 13
Al Bano & Romina Power - Liberta
6 days ago 00:05:19 1
How to Grow Elephant Garlic in Containers – The Organic Way! 🧄#garlic #gardening #containergardening
1 week ago 00:00:26 1
Flower field painting/ easy acrylic painting for beginners
1 week ago 00:25:49 1
Look at This Plastic Bottle Garden – You’ll Regret Not Knowing Sooner!
1 week ago 00:58:12 2
ALIEN ABDUCTION, BLACK EYED KIDS AND ONE GIANT BUG (SN 18 EP 41) TRUE PARANORMAL EXPERIENCES
1 week ago 00:07:36 2
Eye splice in double braid polyester rope
1 week ago 00:03:23 3
Killswitch Engage - Collusion
1 week ago 00:11:41 1
I UPGRADED new LEGO minifigures!
1 week ago 00:02:02 1
Imagine Peace Tower - a beacon to world peace
1 week ago 00:04:34 1
Janiva Magness ~ You Were Never Mine
2 weeks ago 00:03:47 2
SCOOTER - HOW MUCH IS THE FISH (Metal cover)
2 weeks ago 01:29:41 1
Ancient DNA Reveals Hidden Migrations: Uncovering the Secrets of Human Evolution & Expansion
2 weeks ago 00:04:22 1
Real installation of container house / modular homes / sustainable home
2 weeks ago 00:02:54 1
The Future of Hydrogen Energy: Clean Power & Vehicles | How They Work & What’s Next
2 weeks ago 00:23:30 1
Terrifying Truths Learned on Carnivore
2 weeks ago 01:32:50 4
Human Flourishing & The Crime of the Century | The Acceptance of Life Podcast Ep. 03
2 weeks ago 00:04:45 1
Как Сделать МЕРЕНГОВЫЙ РУЛЕТ / Готовим Дома РУЛЕТ
2 weeks ago 00:02:47 4
A Day To Remember - LeBron (Official Audio)
2 weeks ago 00:36:51 1
💥 Breaking! Protestant Church ⛪ in England 🇬🇧 on Path to Holy Orthodoxy ☦️
2 weeks ago 00:01:51 1
Automatic Vacuum Packed Fresh Sweet Corn Cob Making Production Line